Role and Functions of Law Paper

Based on reading from the week 1 material and the case brief given from week 1, there will be an explanation of how the Supreme Court’s language and results of the case reviewed show the preemptive power of congress in upholding the laws set forth by congress in opposition from the State Law. There will also be a review of the rulings effect on other states and peoples’ rights. The review of congresses decision about preempting state law in this case shows that the government has supreme rule over the land and in this case used it to protect the tobacco industry. Business law and law in society will also be reflected upon and how it might relate to a past or present job opportunity. In review of the Case Brief Cipollone v. Liggett Group, Inc. , it is clear that given the Supreme Court’s language and result of the case, that the preemption power of congress is too narrow. The basis for this case was the fact that the state law was conflicted with federal law regarding advertising and marketing techniques for the tobacco industry. Federal law is supreme when there are conflicting issues. A reason this could be viewed as too narrow, is because if there are any conflicting laws between state law and federal law there should be language in the statute that directly states the regulations and requirements or if there is not a direct statement, the state law would be preempted if it conflicts in any way with federal law. The Supreme Court’s ruling does not bar any resident from New Jersey or any other state, from bringing a suit against the tobacco companies. It shows that there were specifically enacted laws set-forth by congress that addresses the tobacco companies and how they can market and label the product. Based on this case, any person has the right to legally go after a tobacco company. This case is a great example of how state rules cannot conflict with federal law because the Supreme Court will use the Supremacy Clause to overrule the state law. Congress would want to preempt state law regarding the advertising and promotion of tobacco products because of taxes. The Federal Government makes money from cigarette sales and manufacturing. By congress being involved at a federal level it prevents the states from becoming involved at and preventing this flow of income for the Federal Government. Tobacco has recently been an increasing health issue and the government is protecting the tobacco industry. One reason for this could be the influence of the big tobacco companies in politics and how they can contribute to certain persons to get laws enacted in their favor. The functions and role of law in business and society are vast and must be narrowed down for better understanding. Law is important to businesses because it not only protects the business but it gives the business guidelines to follow to ensure fair dealing and also reliability of business transactions. It important that a business understand that there are rules that must be followed when conducting day-to-day transactions and they will be held accountable for their actions. Law regulates society by also holding individuals accountable for their actions. The law essentially defines the rules and also defines what happens if the rules are broken by an individual or business. The law affects my current position in sales and construction because when I moved into this position and with my current employer, I came from a competitor. This caused a few legal issues with proprietary manufacturing processes and my knowledge of these processes. I was required to sign confidentiality agreements about not sharing the information and processes I learned at my previous employer. The law protects my previous employer by not allowing me to share their manufacturing secrets with my current employer. After reviewing the case it appears that many of the laws enacted by congress are intended to protect certain industries or people in industries against local and state law. This helps avoid further litigation for the same issues time and again. This case showed the jurisdiction of where federal law and state laws are protected and how effective they are in court. Role and Functions of Law Paper Role and Functions of Law Paper Estella Ponce LAW/421 April 24, 2013 ROGER RODRIGUEZ Role and Functions of Law Paper According to Merriam Webster Online, law is â€Å"a binding custom or practice of a community; a rule of conduct or action prescribed or formally recognized as binding or enforced by a controlling authority,† The role and function of law is to maintain peace, personal freedom and social justice. What is Law? The meaning of Law functions is to maintain social control as well as to protect the public in resolving disputes in a peaceful manner.Laws are also facilitating an orderly change by spelling out acceptable processes for instituting change. Constitutional laws outline what governments can and cannot do. Law has been defined in so many ways. A body of rules of action or conduct prescribed by controlling authority, and having legal binding force (Melvin, p. 4, 2011) is one of the most generally accepted definitions Essentially law provides a way of resolving d isputes and dealing with individual who break the rules and regulations set forth from our government.Role of Law in Business Since the body of American law is so diverse, business law is broken down into three categories: †¢Criminal and Civil Law – These laws are of criminal or civil nature. Criminal law is for the protection of society of an individual breaking the law. Most violators are subject to fines and possibly imprisonment. Civil law are designed for individuals to be compensated for losses as a result of another’s actions. Substantive and Procedural law – Substantive law provides individuals with social rights and duties while procedural law gives structure for pursuing substantive rights. †¢Public and Private Law – Public law is the defining framework between an individual wand the government. Private law is where an individual contracts with each other where no specific statues or regulations are involved. These categories of law ar e very important to businesses and society, by having guidelines setup for individuals to abide by. These laws were also made for the protection of society (Melvin, p. 18, 2011). Role and Functions of Law Paper Role and Functions of Law Paper Estella Ponce LAW/421 April 24, 2013 ROGER RODRIGUEZ Role and Functions of Law Paper According to Merriam Webster Online, law is â€Å"a binding custom or practice of a community; a rule of conduct or action prescribed or formally recognized as binding or enforced by a controlling authority,† The role and function of law is to maintain peace, personal freedom and social justice. What is Law? The meaning of Law functions is to maintain social control as well as to protect the public in resolving disputes in a peaceful manner.Laws are also facilitating an orderly change by spelling out acceptable processes for instituting change. Constitutional laws outline what governments can and cannot do. Law has been defined in so many ways. A body of rules of action or conduct prescribed by controlling authority, and having legal binding force (Melvin, p. 4, 2011) is one of the most generally accepted definitions Essentially law provides a way of resolving d isputes and dealing with individual who break the rules and regulations set forth from our government.Role of Law in Business Since the body of American law is so diverse, business law is broken down into three categories: †¢Criminal and Civil Law – These laws are of criminal or civil nature. Criminal law is for the protection of society of an individual breaking the law. Most violators are subject to fines and possibly imprisonment. Civil law are designed for individuals to be compensated for losses as a result of another’s actions. Substantive and Procedural law – Substantive law provides individuals with social rights and duties while procedural law gives structure for pursuing substantive rights. †¢Public and Private Law – Public law is the defining framework between an individual wand the government. Private law is where an individual contracts with each other where no specific statues or regulations are involved. These categories of law ar e very important to businesses and society, by having guidelines setup for individuals to abide by. These laws were also made for the protection of society (Melvin, p. 18, 2011).

Corona Beer

Grupo Modelo S. A. de C. V. was formed in 1992, and opened its first brewery in 1925. It’s Mexico’s largest beer producer and distributor. Among the company’s many brands was Corona Extra, which had been the world’s fourth best selling beer in terms of volume. Under the operational direction of Diez, Modelo started producing Corona in clear quarter bottles in response to consumers’ preference for clear glasses. It became the strength and let it become popular. What’s more, Modelo bought the brands and assets of Toluca Mexico Brewery as well as the country’s oldest established brand of beer, Victoria.It led the company to have a strong growth. At this moment, the opportunity was that most local competitors were selling beer to the American army for WWII, so Modelo aimed to concentrate domestic market and improve distribution methods and production facilities within Mexico. Another economic factor was Mexico became industrialized, and it ’s infrastructure allowed for large scale distribution. Because of the two factors, Modelo was successful to be a local leader. And Corona was listed on the Mexican Stock exchange in 1994.Mexico, the world’s 11th most populated country was one of the largest beer markets in the world and it’s also the birthplace of most affluent tequila. So there’s no doubt Modelo have lots of competitors, especially FEMSA. Though Modelo had built up a strategic alliance with Anheuser-Busch to broaden its international impact, FEMSA was distributing Coca-Cola products in Mexico and had a partnership with Heineken—Modelo’s international competitor to attack the U. S. Market. Heineken planned to be the market leader in US through aggressive campaign.So Modelo made efforts to be more competitive. According to Modelo’s expanding abroad, Corona distributed by Amalgamated Distillery Products Inc, and because of its unique products, it had become the second most popular imported beer in United States. Then, a political problem—coupled with federal excise tax on beer made Corona’s distributors absorb the tax rather than pass it on to consumers. However, it turned to be Corona’s strength that the sales increased ever since and Modelo also took advantages of NATFA environment.As a result, Modelo was exporting five kinds of beer to United States and three brands ranked among eight first. Since its entrance into the American beer market, Corona had built a market campaign around the idea of â€Å"fun in the sun. † It’s a brilliant and unique market campaign. It was born out of Modelo’s international expansion strategy of giving autonomous control to experienced, local distributors. It targeted on women and party scenes. Then Corona was able to get the non-beer-drinking population to drink beer by its unobtrusive and bland taste.Furthermore, with its advertising slogan, it built strong images of esca pe, enjoyment and relaxation successfully. However, Modelo were still facing challenges. Though FEMSA did not experience the same in the international arena as Modelo, it is the exclusive distributors of Coca-Cola and Central America. Though Corona surpassed Heineken as Ameriaca’s top imported beer, but it’s because the failure that Heineken always advertising for the superior quality ,with little attention devoted to any other aspect of its brand.So Medelo had to face its new status to make its success story a sustainable one. To conclude, for Modelo, it’s strengths are 1) Mexico’s largest beer producer and distributor 2) Corona Extra had been the world’s fourth best selling beer in volume 3)Top imported beer in US 4) Distributors absorb the tax rather than pass it on to consumers 5) Brilliant market champaign 6) Strong brand image. It’s weaknesses are 1) Lack of merger with other companies 2) Lack of partners. For the direct environment, i t targeted those non beer drinking people especially women.Modelo’s direct competitor in Mexico is FEMSA. It’s the distributor of Coca-Cola and Central America and it has high quality and have a partnership with Heineken to attack the US market. The international competitor is Heineken. It’s main importer in US and it planned to be the market leader through market campaigns. For the global environment, the political factors are 1)North American Free Trade Agreement (NAFTA) environment. 2) Federal excise tax —-absorb the tax rather than pass it on to customers. The economical factor is Mexico is the world’s 11th most populated country.The social factors are 1)Mexico is the birthplace and still home of the most affluent tequila market. 2) It targeted non beer drinking population especially women. The technology factor is the advertising style and the legal factors are laws and regulations of alcohol. Above all, Modelo can focus on advertising more to increase the number of non beer drinking consumers and develop more customers to establish a supply chain to make products available in more places. What’s more, Modelo can also expand its international market not only in US and Europe but in Asia.

I need a review of the movie Go Tell The Spartans

I need a of the Go Tell The Spartans - Movie Review Example The men are inexperienced and have no real sense of what the war will entail. They are badly outnumbered by Viet Cong troops and there are reports of fighting in the area. Their commander is named Barker, and he is the heart and soul of the film. Barker has fought in many wars and is world-weary and wise. He knows his men are foolish and outnumbered. He does everything he can to teach them to prepare themselves for battle. But the men at Muc Wa are just one cog in a larger wheel. We see how the bureaucracy of the American armed forces slows things down and prevents soldiers from showing initiative. Even after numerous complaints, Barker is still undermanned. In a sense, he is only awaiting his own death. In order the fully understand this excellent film, it is important to understand America's role in Vietnam during the period. Unlike the Second World War, where the purpose of the U.S. was clear, and its vital interests at stake, the Vietnam War had an unclear objective. Americans ha d trouble understanding why it was in their national interest to send hundreds of thousands of soldiers to this far-away land. Some of the actions taken by their own soldiers ashamed them, and the losses of life were enormous. Many aspects of the war in retrospect seem surreal.

Why I want to be a school and guidance counselor Essay

Why I want to be a school and guidance counselor - Essay Example My ethical concern for this job selection is it gives me the opportunity to spend time with children in the place of their parents and determine their study patters that will effectively gain the trust of students. The level of job satisfaction is another aspect that attracts me to this job as it opens the windows to explore the characters of students and effectively guide them against immoral and unethical tracks of their juvenile imperfections. Though this job is frustrating for lack of authority to instruct strongly, it gives a lot of personal pleasure when the individuals are motivated through the right path against possibilities of drug abuse and psycho-sexual disorders of adolescence. As a professional graduate in student guidance, I have al due regards for the empowerment of students from every walk of their merits and disabilities. I am enthusiastic to work for the Individualized Education Program (IEP) of the USA as it gives me opportunities to meet the challenges of the profession in order to make me strong individual and a potent choice of my employers. In this program, I can assure personalized care for the students identified with intellectual and physical disabilities and guide them along with post school tutoring. This job is entirely challenging and rather physically and emotionally demanding, yet I can claim high level of ethical satisfaction and reputation among their parents with equal reward from the Almighty. I also think that my successful endeavor in this field attracts me the generosity of my employers who hopefully benefit me financially for my efforts. My career option as student counselor is also powered by enthusiasm for helping the academic requirements of children whose parents are subject to frequent transfer from their work places. Though a majority of the civilian employees are stable

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Cabaret Film (1972) Film Essay Example | Topics and Well Written Essays - 1000 words

Cabaret Film (1972) Film - Essay Example Let us now look into film by segmenting it, so as to understand the film better. The film begins with a cabaret song performed by Joel Grey and other cast that actually welcomes the audience. Here Bob Fosse blends the introduction of Michael York, the scene takes a transition from the cabaret to the Berlin railway station and this transition happens abruptly with no effects of fade or wipe. The first scene completely focuses on the advent of an English man who enters Berlin with a hope to find a career as an English tutor. Soon after the completion of the first scene, there is actually a continuity of the English man finding himself a place to live in. Here Bob Fosse brings in the character around which the story actually revolves, Sally Bowles (Liza Minnelli). The English man meets the singer Sally Bowles and finds accommodation in her place. In this particular scene the director introduces Sally Bowles as atypical woman with a strong desire to become an actress. This also gives us an impression about the girl who has a quite different attitude where she convinces the English man about the rent and persuades him to stay. The following scene shows Sally Bowles performing at the cabaret and this indeed is a perfect continuation of the previous scene letting the audience know about Sally and her profession. In this performance of Sally Bowles one has to definitely appreciate the work done by John Kander where his tunes leave the audience foot tapping. The third scene begins with a fade and this shows Sally Bowles talking over the phone to the English man Brian Roberts and here comes in the character of a Jewish man, who Sally introduces to Brian and suggests him taking English lessons from Brian. In the following scenes Sally discloses her strong desire to become an actress to Brian and in the same scene Sally screams under a railway bridge and asks Brian to do the same. This scene particularly tells us about the typical behavior of Sally. The following scenes al so have a good sense of continuity where Sally seduces Brian and Brian refuses romancing her. At the end of the scene doubts entail us about the sexuality of Brian for he has a different outlook for women. All the scenes so far have a cause to happen and their effect felt in the progressive sequences. The upcoming scenes find us in little sense of ambiguity of as to why the parallel story of the Jewish man and his love interest, Natalia happen to take place in this track of the movie revolving around the cabaret singer Sally. But little would we know at the beginning, of why this parallel track runs and at the end of the film this would find a meaningful integration with the main track of the movie. The scene, in which the Jewish woman, Natalia seeking to learn English from Brian pronounces â€Å"phlegm† amusingly, is certainly a hilarious scene with Sally’s sarcastic comments. Though some scenes merely appear as fillers their sense of appearance are found at the end. The Jewish man trying to please his love interest is one among them. The romance between Sally and Brian finds great sense as it is placed in the right time and the director’s art in making the scene a non deliberate one is impeccable. A song (â€Å"may be this time†) placed at this point is a mere justification of the emotions of a cabaret singer. The scene in which Sally speaks to the Natalia about physical relationships actually makes little sense as this has got

Public Company Accounting Reform and Investor Protection Act Essay

Public Company Accounting Reform and Investor Protection Act - Essay Example This state of affairs triggered a requirement for a regulation that could establish legal requirements for companies to ensure that their systems are controlled and the information they publish conform to the actual status, and is not altered, modified or changed with an intention to deceive anyone. The Sarbanes Oxley Act (also known as known as the Public Company Accounting Reform and Investor Protection Act of 2002 and commonly called SOX or Sarbox (Wikipedia.org, 2007), was implemented in 2002 to regain public's trust in the accounting and reporting practices of companies in US, to reinforce investment confidence and protect investors by improving the accuracy and reliability of corporate information with regard to finance, operations and information systems. A brief description of key provision of SOX is provided below: A Public Company Accounting Oversight Board (PCAOB) was established as a result of the passage of the act, to ensure that interests of the investors in public companies are secured, and the audit reports are developed and represent true and fair opinion on the affairs of the company (FindLaw.com 2002). The key functions and duties of PCAOB as documented in the law are as follow: The 'independence' of the auditor is critical for performing any audit related activity for any client. ISACA (Information Systems Audit and Controls Association) (2006) requires auditors to be independent of auditee in both attitude and appearance (professional independence) and the entire audit function to be independent of the area or activity being reviewed to permit objective completion of the audit assignment. The SOX act requires the auditors to be independent. The law states that auditors should not have any operational and/or decision making role for the activity which they are auditing. Corporate Responsibility The act requires public companies to certify in their financial reports that a senior manager has reviewed the report and that the report does not have material misstatements. As per section 302 of the act, the senior management is responsible to develop and implement system of internal controls, and compliance systems. The act requires that the corporate financial statements should have following certifications: The signing officers have reviewed the report The report does not contain material misstatement or material omission or is misleading The financial statements and information fairly represent the factual position and health of the company The signing officers are responsible for internal controls and have reviewed internal controls in previous 90 days Significant changes to internal control environment The report should have a list of all deficiencies in the internal controls and information on any fraud involving employees Enhanced Financial

What does the bible mean to me Essay Example | Topics and Well Written Essays - 250 words

What does the bible mean to me - Essay Example The word â€Å"Bible† comes from Greek and can be translated as a â€Å"book†. Though Bible consists of more than seventy books, which have been written in different times and by different authors using various genres, literary styles and even languages, they all are perceived as one united and undivided continuous text that recreates life experience, moral norms and sources of human wisdom. People who have not read this book can not consider themselves as educated. However, I am confident that everyday the number of such people decreases constantly. Being written by inspired people, Bible is not merely work of fiction, but it is the greatest book of human history that contains magnificent and philosophic studies about our world, inhabitants, and eternal morality along with spiritual values. Urgency of this book is undisputed, because with its help we are able to find answers and explanations of such notions as life and death, fate and human soul, good and evil and others. Bible teaches us how to live, what we should do, what things should be unacceptable in our conscience, what kind of people we must strive to become and which negative traits of our characters ought to be changed. Bible gives us a great hope for bright and serene future persuading to believe in a life after death and Heavens. Reading this Holy Book, I comprehend that person can insure calm and happy life only with a help of conceiving thoughts and apprenticeships of Jesus Christ who persistently invites to open our hearts for God that manages to touch the most remote depths of human soul. Bible makes us believe that God is real. Every person is given life to prepare own self for eternal life on the Heavens. Bible propagandizes ethical and esthetical experience of humanity. All disappointed people refer to this book and keep on searching for the point of life that lies in religion. Hence, our trust in God helps us to live dignified lives on the Earth before being

Industrial Services of America, Inc. and Its Strategies Essay

Industrial Services of America, Inc. and Its Strategies - Essay Example On liquidation, Harry Kletter purchased majority of the shares and on the eve of 1980s, he started a new company concerned with the selling of equipments associated with handling and disposal of solid waste. The new company operated with a new trade name known as Waste Equipment Sales and Services Company (WESSCO). WESSCO finally joined with CWS (Computer Waste Systems), a company that had specialized in giving consultations in relation to solid waste management to a number of businesses operating in diverse industries. The merging of these two firms led to the establishment of business operations headquarters at Louisville in Kentucky. Since then the company has acquired a number of recycling units in several regions. Besides purchasing of business units, the company has also seen itself enter into merger with other companies. Currently, the company is resorting to contracting third parties’ services in collecting and disposing solid waste. This will see ISA increase its cove rage area in regards to offering its services leading to amplified profits. Although the company has its operation in two sectors, that is, recycling and waste management, ISA is considering about concentrating in recycling activities. The reason behind this decision might be due to its efficiency in the recycling operations (Consonni, Giugliano & Grosso, 2005). External environment Industrial Competition The recycling business especially in the metal sector is very competitive in the US market. ISA faces stiff competition from those firms that have access to metal source. It is alleged that some companies have access to cheap scraps giving them a chance to sell the finished products at relatively low prices. The tough competition is further enhanced by existence of rivals that have adequate financial capacity, physical resources such as trucks and efficient marketing strategies among other factors such as large market share. ISA also fears that its competitiveness might adversely b e affected by weak economy and unfavorable market conditions (Consonni, Giugliano & Grosso, 2005). Risk Associated With Depending Upon One Customer ISA is exposed to great risk by depending on one customer that contributes over 60% to its profit. ISA majorly depends on North American Stainless pertaining to sale of its recycled metals. Environmental Regulations and the Government Policies The government and the environmental organizations frequently monitors the operations of all company’s that deals in recycling of materials in addition to management of wastes to ensure their practices are in line with laws and regulations governing the environment as well as company’s operations. Such policies entail environmental, health and safety issues such as Occupational Safety and Health Administration. Failure to comply with these laws ISA might find itself in the trouble of paying fines and thus affecting their profitability (Cointreau, 2001). Internal organization Managemen t team ISA brags of having experienced and qualified management team including the president and chief operating officer, Mr. Brian Donaghy as well as the vice president of the ISA Recycling, Mr. James Wiseman. The team management is cooperative and competitive and work closely with its employees to achieve the organizations’ goals. Employees At the end of 2010, ISA had about one hundred and eighty five employees who were employed on a full time basis. Ninety-eight of the employees are employed in recycling;

Starving For The Gold-Coursework Coursework Example | Topics and Well Written Essays - 2000 words

Starving For The Gold- - Coursework Example to educate people to the problems women athletes face in hopes that with more people being more knowledgeable on the topic, hopefully changes can be made. The basic cause of the problem, as Robinson states it, is that the coaches of female athletes pressure them to be as thin as possible. For instance, Robinson mentions how one female athlete she talked to said that her coach â€Å"held contests to see who could leave the most food uneaten on her plate at training camp† (yr). This obviously is going to have a negative effect on female athletes, especially when considering that females are pressured into being as thin as possible in society as it is. Another practice mentioned is that female athletes will have their body fat calculated and then compared with the other athletes; the idea is to encourage all of the female athletes to be as skinny as possible. Another female athlete, speaking from her experience with athletic amenorrhea, which is the cessation of the menstrual cycle due to extremely low body-fat composition, stated that â€Å"Pressure was always felt to be lean, and considerable emphasis was placed on being beneat h 12 percent body fat composition. It seemed that the primary goal was to maintain a low-body fat composition† (yr). Overall, as opposed to training female athletes to be fit, they are being trained to be as skinny as possible. This encouraging to be overly thin is giving these athletes eating disorders, but this is not the main motivation behind these practices as Robinson states. The main reason that these sort of practices can be gotten away with is because there is a perceived male-domination in sports. When one views the kind of changes that the coaches are encouraging their female athletes to make, Robinson states that it is not difficult to see that they are trying to make their female athletes resemble their male athletes. This practice Robinson traces back to the 70’s, and in particular the athlete Olga Korbet, as the

Dc V. Heller Essay Example for Free

Dc V. Heller Essay Winter Honors Civics amp; Economics B-1 Case name: DC V. Heller A controversial topic came about in the year of 2008. It was concerning whether or not DC’s gun law was following along the lines of the Second Amendment Rights. A man by the name of Dick Anthony Heller was a special police officer and had gone in to register for a handgun for his home. The true underlying issue was whether or not the rights were protected under the Second Amendments which states: The right to bear arms. The uprising stipulation in the District of Columbia is that they have a state law that concerns the registration of a handgun. When looking into further depth of the law the following things must be adhered to in the stipulations of having a hand gun. It states that in order to have a registered handgun it must be â€Å"†¦unloaded and disassembled or bound by a trigger unless they are being used for lawful recreational activities or located in a place of business. DISTRICT OF COLUMBIA v. HELLER. n. pag. SIRS Government Reporter. Web. 24 Jan 2013. ) When the case was first taken up before it came to the Supreme Court, in the lower court system the verdict was dismissed until it was later reversed. The two court systems that herd the case before the Supreme Court were the Courts of Appeals and the district court. The arraignments for the plaintiff were; Dick Anthony Heller was dismissed for another four years until it was taken up again. In the arraignments for the Defendants â€Å"†¦DC found that the challenge to the constitution and its validity was without merit †¦Ã¢â‚¬  It seems as if they were trying to throw salt on the technicality of what the Constitution says in Amendment two and the right to bear arms. In the end what the plaintiff really wanted were his rights to be acknowledged, being that it’s in the constitution and he was a police officer at the time. As well as he wants to be able to have a gun in his house for protection as most people would want. In the lower court systems had voted against what the plaintiff had brought forth as evidence. When it was finally hear in the Supreme Court the case was ruled in favor of the plaintiff. Justice Stevens wrote majority of the decision by stating that the Second Amendment is given to everyone that is a citizen of the United States and that right can’t be taken away to a certain extent. There were concurrent opinions that were made by Justice Stevens who said if things are within our rights then we should be able to obtain them and use them to the fullest extent of our abilities. District of Columbia v. Heller a? â€Å" Case Brief Summary. Lawnix Free Case Briefs RSS. N. p. , Fall 2008. Web. 28 Jan. 2013. ) The dissenting arguments of opinion came from Stephen Breyer, who stated that the second amendment is only for militia related ordeals and not a matter of being used as self defense. Heller at the time was a special police officer so therefore it was really questionable on w hy the lower court verdict had made such a big deal out of the entire situation. The majority opinion was in favor of the plaintiff who wanted to register for a hand gun in the first place for the protection of his home. The importance of the case was that a man was being withheld his legal rights that are stated under the second amendment. It showed as well that a state law can be overturned by a higher government system. This case specifically was a major part of the Constitution because it showed a prime example of states trying to withhold the rights that we have as citizens. It brings light to the different things that certain state governments try to bring down and cover up.

Corporate Strategy Tata Corus Acquisition Marketing Essay

Corporate Strategy Tata Corus Acquisition Marketing Essay Corporate Strategy is about enabling an organization to achieve and sustain superior overall performance and returns. It is a core responsibility of senior executives and encompasses a range of critical activities, from defining and refining corporate vision to strategic performance measurement and management. Organizations are facing exciting and dynamic challenges in the 21st century. In the globalised business, companies require strategic thinking and only by evolving good corporate strategies can they become strategically competitive. A sustained or sustainable competitive advantage occurs when firm implements a value creating strategy of which other companies are unable to duplicate the benefits or find it too costly to initiate. Corporate strategy includes the commitments, decisions and actions required for a firm to achieve strategic competitiveness and earn above average returns. Corporate growth strategies Growth can be achieved by different means. One approach is from within and another is from outside -that is combinations. Different forms of combinations are: Amalgamation/Merger: Merger takes place when there is a combination of two or more organizations. Merger does create a new corporation. Acquisition/takeovers: One Company acquires another companys controlling interest. The acquired company operates as a separate division or subsidiary by offering cash or securities in exchange for majority of shares of another company. Sales of Assets: A company can sell its assets to another and cease to exist. Holding company acquisition: This is a quasi merger. Either the total or majority of a firms stock will be acquired. The purpose is only management and control of other. Mergers can also be classified into the following forms: 1. Horizontal mergers take place when there is a combination of two or more organizations in the same business, or of organizations engaged in certain aspects of the production or marketing process. For instance a company making footwear combines with another retailer in the same business. 2. Vertical mergers take place when there is a combination of two or more organizations not necessarily in the same business, which complement either in terms of supply of materials (inputs) or marketing of goods and services (outputs). For instance a footwear company combines with a leather tannery or with a chain of she retail stores. 3. Concentric mergers take place when there is a combination of two or more organizations related to each other either in terms of customer functions, customer groups, or the alternative technologies used. A footwear company combining with hosiery firm making socks or another specialty footwear company, or with a leather goods company making purses, handbags, and so on. 4. Conglomerate mergers take place when there is a combination of two more organizations unrelated to each other, either in terms of customer functions, customer groups, or alternative technologies used. For Example: A foot wear company combining with a pharmaceuticals firm. In our project report, we explore the various facets of perhaps one of the most important acquisitions ever made by an Indian Company, that of Tata-Corus. History of the two giants TATA Group Tata Group is an Indian multinational conglomerate company headquartered in the Bombay House in Mumbai, India. In terms of market capitalization and revenues, Tata Group is the largest private corporate group in India. It has interests in chemicals, steel, automobiles, information technology, communication, power, beverages, and hospitality. The Tata Group has operations in more than 80 countries across six continents and its companies export products and services to 80 nations. The Tata Group comprises 114 companies and subsidiaries in eight business sectors. Its total revenue is $67.4 billion, profit $1.74 billion and total assets $52.8 billion. The main aim of the TATA group is to improve the quality of life of the community it serves. The group has played a pioneering role in a variety of fields after Indias independence and it is widely respected for the initiatives it has taken in different fields for upliftment of the country. TATA Steel Tata Steel Group is one of Indias largest integrated private sector steel companies. The group manufactures and distributes steel, welded steel tubes, cold rolled strips, bearings, and other related products. Tata Steel Group operates across Asia, Europe, and Australia. Tata Steel Group is headquartered in Mumbai, India and employs about 86,600 people. The group recorded revenues of INR 1,473,292.6 million (approximately $32,147.2 million) in the financial year ended March 2009 (FY2009), an increase of 12% over FY2008. The operating profit of the group was INR141,279.5 million (approximately $3,082.7 million) in FY2009, compared with an operating profit of INR 141,213.4 million (approximately $3,081.3 million) in FY2008. The net profit was INR49,509 million(approximately $1,080.3 million) in FY2009, a decrease of 59.9% compared with FY2008.It is the worlds sixth largest steel company with capacity of 31 million tones per annum (tpa).The group is the worlds second most geographically diversified steel producer, with operations in 26 countries and commercial presence in more than 50 countries. Tata Steel Groups strong market position gives it advantage of scale and increases its bargaining power. The story of Tata Steel is a century old. And so is the story of steel in India. Etched with the visions and hardships of a single man, the story has flowed through ages to re-define steel in every way. The saga, which started in 1907, completed a century of trust in 2007 and carries on. Over the years this one company has discovered different avenues of effective steel utilisation and its story defines and re-defines conventional wisdom in more ways than one.The Steel Company obtained its first colliery in 1910, adding six more in course of time. Several mines were spread over the states of Bihar, Orissa and Karnataka. The Tatas soon became the first to own a fully mechanised iron ore mine in India at Noamundi. The Coal Beneficiation Plant at West Bokaro undertook beneficiation of low-grade coal, thus helping in the conservation of the fast dwindling resources of high quality coal. The collieries, the mines and the quarries together furnish the bulk of the raw material requirements of the plant. When the entire world was reeling in the Great Depression, the Tatas survived and supplied nearly three-fourth of the countrys steel requirements. By the Second World War, Tatas production capacities had expanded enough to make their prices lower than those of steel produced in England, raising them to an authoritarian position. Post-Independence the Tatas decided to set on the Herculean task of nation building. The much-required steel for the newly devised Five-year Plans came from the Tata factories. The Company undertook the Howrah Bridge in Calcutta, the Bhakra-Nangal Project and the Damodar Valley Corporation, the port at Kandla, the city of Chandigarh and many more important projects. The last decade of the twentieth century happened to be a very hectic period of self-renewal and growth for Tata Steel. An extensive technological overhaul, several improvement projects, cost control measures, optimising IT support and a strong customer-centric approach were all instrumental in finding the right direction for changing outlooks. At the turn of the millennium, Tata Steel had earned the complete trust of the whole wide world and emerged as a strong entity in the global steel industry.The last decade has been marked by Tata Steels prominent role in the overall development of the country, even during phases of economic turbulence and its decisive foray into more and more global territory. Intense strategic thinking about future expansions, plans for organic growth and initiation of new projects are a few highlights in Tata Steels expanding and more penetrative roles in the larger perspective. The acquisition of NatSteel in 2004 was Tata Steels first overseas acquisition a nd the series of joint ventures and mergers that followed found a peak when the acquisition of Corus, happened in April 2007. But in every positive step that the Company has taken towards growth and expansion, involving diverse cultures and geographies, Tata Steel has never lost sight of its great heritage of social and community responsibility. The long journey of Tata Steel has seen the Company re-define its performance parameters in a number of ways to become the global steel industry benchmark for value creation and corporate citizenship. It ensures a total commitment to its ethical business practices and a people oriented vision. SWOT Analysis Of Tata Steel Strengths Strong market position Integrated steel operations in India Strong research and development (RD) capabilities Weakness Dependence on third party suppliers for raw material in Europe Dependence on Europe Opportunities Expansion in India Joint ventures to develop mining activities Anticipated demand for steel in India Threats Consolidation in the global steel industry Environmental regulations Corus Group Corus Group plc was formed on 6th October 1999, through the merger of two companies, British Steel and Koninklijke Hoogovens, following the privatization of many steelworks companies by the U.K. government. The company consists of four divisions which include: Strip Products, Long Products, Aluminum and Distribution and Building Systems. With headquarters in London, Corus operates as an international company, satisfying the demand of many steel customers worldwide. Its core business comprises of manufacturing, development and allocation of steel and aluminum products and services.The company has a wide variety of products and services which comprise of the manufacturing of electrical steel, narrow strip, plates, packaging steel, plated steel strip, semi finished steel, tube products, wire rod and rail products and services. However, the company is also engaged in providing a variety of services including design, technology and consultancy services. Corus products and services are acq uired by customers from diverse fields such as commercial and military aerospace ventures, the automotive, construction, engineering, defense and security, as well as the rail and shipbuilding industry. In terms of performance, the company is regarded as the largest steel producer in the UK. It is headquartered in London, the UK and employs 21,300 people. The group recorded revenues of  £9,733 million during the fiscal year ended December 2006, an increase of 6.3% over 2005. The operating profit of the company  £457 million a decline of 28.9% over 2005. The net profit was  £229 million in fiscal year 2006, a decline of 49.2% over 2005. SWOT Analysis Of Corus Group Strengths Diversified product portfolio Strong technology Diversified geographic presence Weakness Rising expenses Lack of scale Weak returns Opportunities Positive outlook for the aircraft industry Growing US construction industry Growing Chinese steel market Threats Economic slowdown in the US and Eurozone Consolidation in the global steel industry Increase in energy and fuel costs The Deal The deal (between Tata Corus) was officially announced on April 2nd, 2007 at a price of 608 pence per ordinary share in cash. This deal was a 100% acquisition and the new entity was be run by one of Tatas steel subsidiaries. As stated by Tata, the initial motive behind the completion of the deal was not Corus revenue size, but rather its market value. Even though Corus is larger in size compared to Tata, the company was valued less than Tata (at approximately $6 billion) at the time when the deal negotiations started. But from Corus point of view, as the management has stated that the basic reason for supporting this deal were the expected synergies between the two entities. Corus has supported the Tata acquisition due to different motives. However, with the Tata acquisition Corus has gained a great and profitable opportunity to make an exit as the company has been looking out for a potential buyer for quite some time. The total value of this acquisition amounted to à ¢Ã¢â‚¬Å¡Ã‚ ¤6.2 billion (US$12 billion). Tata Steel the winner of the auction for Corus declared a bid of 608 pence per share surpassing the final bid from Brazilian Steel maker Companhia Siderurgica Nacional (CSN) of 603 pence per share. Prior to the beginning of the deal negotiations, both Tata Steel and Corus were interested in entering into an MA deal due to several reasons. The official press release issued by both the company states that the combined entity will have a pro forma crude steel production of 27 million tones in 2007, with 84,000 employees across four continents and a joint presence in 45 countries, which makes it a serious rival to other steel giants. The official declaration of the completed transaction between the two companies was announced to be effective by Court of Justice in England and Wales and consistent with the Scheme of Arrangement of the Tata Steel Scheme on April 2, 2007. According the Scheme regulations, Tata Steel was required to deliver a consideration not later than 2 weeks following the official date of the completion of the transaction. At the time of acquisition, nearly 49% of Corus was owned by British shareholders, 11% by North American shareholders, 10% by Dutch shareholders and another 30% by shareholders in Germany, France, Belgium and other countries. At first, it had appeared that Tata would get Corus unopposed as the bid had received favourable initial response from the Corusà ¢Ã¢â€š ¬Ã… ¸ Board. The Corus board had unanimously accepted Tata Steels takeover proposal and had even recommended it for shareholders approval. However, things changed soon after CSN entered the fray, making a more competitive offer than Tata. The bidding process continued for three months with CSN countering each successive move by Tata with a higher bid for the equity of Corus. For example, when Tata raised their bid to $9.2 billion for Corusà ¢Ã¢â€š ¬Ã… ¸ equity in early December 2006, CSN countered it with $9.6 billion within hours of the Tataà ¢Ã¢â€š ¬Ã… ¸s offer. When months of takeover battle could not determine the winner, UKà ¢Ã¢â€š ¬Ã… ¸s Takeover Panel announced that it would hold an auction with a maximum of nine rounds to decide the winner. The auction took place on 30th January 2007. On the auction eve, Ratan Tata along with Tata Steel managing director B Muthuraman were monitoring the Corus auction taking place thousands of miles away in London. The Tata Sons director Arun Gandhi, their investment bankers and advisers were in London representing Tata Steel. The entire deal timeline is detailed below: Deal Timeline September 20, 2006 : Corus Steel has decided to acquire a strategic partnership with a company that is a low cost producer October 5, 2006 : The Indian steel giant, Tata Steel wants to fulfill its ambition toExpand its business further. October 6, 2006 : The initial offer from Tata Steel is considered to be too low both by Corus and analysts. October 17, 2006 : Tata Steel has kept its offer to 455p per share. October 18, 2006 : Tata still doesnt react to Corus and its bid price remains the same. October 20, 2006 : Corus accepts terms of à ¢Ã¢â‚¬Å¡Ã‚ ¤ 4.3 billion takeover bid from Tata Steel October 23, 2006 : The Brazilian Steel Group CSN recruits a leading investment bank to offer advice on possible counter-offer to Tata Steels bid. October 27, 2006 :Corus is criticized by the chairman of JCB, Sir Anthony Bamford, for its decision to accept an offer from Tata. November 3, 2006 : The Russian steel giant Severstal announces officially that it will not make a bid for Corus November 18, 2006 : The battle over Corus intensifies when Brazilian group CSN approached the board of the company with a bid of 475p pershare November 27, 2006 : The board of Corus decides that it is in the best interest of its will shareholders to give more time to CSN to satisfy the preconditions and decide whether it issue forward a formal offer December 18, 2006 : Within hours of Tata Steel increasing its original bid for Corus to 500 pence per share, Brazils CSN made its formal counter bid for Corus at 515 pence per share in cash, 3% more than Tata Steels Offer. January 31, 2007 : Britains Takeover Panel announces in an e-mailed statement that after an auction Tata Steel had agreed to offer Corus investors 608 pence per share in cash April 2, 2007 : Tata Steel manages to win the acquisition to CSN and has the full voting support form Corus Valuation Due Diligence Tataà ¢Ã¢â€š ¬Ã… ¸s original bid for Corus had been at 455 pence a share in mid-October 2006, valuing Corusà ¢Ã¢â€š ¬Ã… ¸s equity at $8 billion. But as a result of the bitter fight with CSN of Brazil, Tata finally paid a price of $12.9 billion in an all-cash deal, raising doubts that the acquisition would likely turn out to be a winnerà ¢Ã¢â€š ¬Ã… ¸s curse. Within weeks of the acquisition announcement, Tata Steel had lost over $1 billion in market capitalization, as the market reacted negatively to the high price paid. The wealth-accretion advantages of the deal, if any, would accrue in the long term. Immediately, it meant raising huge amounts of debt and equity to finance the deal. Both Moodyà ¢Ã¢â€š ¬Ã… ¸s Investors Service and Standard Poorà ¢Ã¢â€š ¬Ã… ¸s said they might lower Tataà ¢Ã¢â€š ¬Ã… ¸s debt rating which meant that debt financing would likely neither be easy nor cheap. To finance the Corus buy, Tata Steel embarked upon what was perhaps the biggest fund-raising exercise by an Indian company. It raised funds through a number of sources. These included a rights issue of equity shares, rights issue of convertible preference shares and long-term debt including foreign currency structured issues. Tata Steel and its fully owned subsidiaries Tata Steel UK and Tata Steel Asia Singapore were involved in the unprecedented fund raising exercise by an Indian company. Tata Steel UK was also the SPV for the Corus takeover. The whopping about $13 billion was planned to have been raised as shown in the table below Company Source Amount ($ Mil) Tata Steel Internal generation 700 Tata Steel External commercial borrowings 500 Tata Steel Preferential issue of equity shares to Tata Sons 640 Tata Steel Rights issue of equity shares to its shareholders 862 Tata Steel Rights issue of convertible preference shares 1,000 Tata Steel ADR/GDR EQUITY ISSUE 500 Tata Steel UK Non-recourse debt raised from a consortium of banks 6,140 Tata Steel Asia Singapore Bridge finance 2,660 Total 13,002 By early April 2007, Tata Steel had completed the $12.9 billion (Rs 52,700 crore) acquisition of Corus Group plc at a price of 608 pence per ordinary share in cash. The enlarged company would have a crude steel production of 27 million tonnes in 2007 and would be the worlds fifth largest steel producer with 84,000 employees across four continents. Need for the Deal Introduction The Tata Iron and Steel Company (name later changed to Tata Steel) was established by Sir Jamsetji Tata in 1907. By 2006 it was Indias largest integrated private sector steel company. With its recent acquisitions and mergers, the company has become a multinational with operations in various countries. It was recognized as the worlds best quality steel producer in 2005. Though domestically the company had seen significant growth in the 100 years, it ranked a poor number 56 globally in terms of steel output. In order to enhance its market share in the global market Tata steel made several smaller foreign acquisitions, including Singapores NatSteel and Thailands Millennium Steel. But these small incremental deals would not enable Tata Steel to capture the sudden opportunity that had arisen in the steel market. We believe that Tata Steel had to act in response to the changing environment, the industry structure and to exploit its competencies and resources at its disposal, which led to its decision of acquiring Corus, a steel firm much bigger in size compared to Tata Steel. We propose to explain the need for the related linked diversification, logic and reasoning behind the deal through the Resource-Based Model of Above Average Returns and the I/O Model of Above Average Returns. Resource-Based Model of Above Average Returns Deriving Synergies There were a lot of apparent synergies between Tata Steel which was a low cost steel producer in fast developing region of the world and Corus which was a high value product manufacturer in the region of the world demanding value products. Synergies also existed in terms of sharing and manufacturing practices, shared services and purchasing. Also there were other synergies between the two companies; Corus was a large player in value-added services while Tata Steel was one of the lowest cost producers of steel in the world. According to Tata Steel Annual Report of 2007-08 the expected synergies and efficiencies had already started flowing in and would bring in annual benefits of USD 450 million per annum by year 2010. Raw Material Tata Steel also has a relative cost advantage because it owns iron-ore mines which Corus did not. Corus was fighting to keep its productions costs under control and was on the lookout for sources of iron ore. (Tata Steel owns enormous volumes of high-quality iron ore and other minerals needed for steel-making. Captive raw materials linkages have given the modernizing and expanding Jamshedpur mill a competitive edge. Tata Steel is set to build greenfield mills in iron ore-rich states of Orissa, Jharkhand and Chhattisgarh). The joint entity will have a self sufficiency in raw material. Cultural There was a strong culture fit between the two organizations both of which highly emphasized on continuous improvement and ethics. Tata steels Continuous Improvement Program Aspire with the core values: trusteeship, integrity, respect for individual, credibility and excellence. Coruss Continuous Improvement Program The Corus Way with the core values: code of ethics, integrity, creating value in steel, customer focus, selective growth and respect for our people. Importantly, the rest of cultural differences between the two companies had been taken care of and the two merged entities were working under their joint management. Tata Steels earnings per share had improved after the merger. Sharing Competencies According to Ratan Tata, post-merger the immediate focus would be on extracting synergies from Corus. He felt that there was scope to make Corus a competitive steel company by inculcating the creativity and cost-consciousness in Corus as had been generated in Tata Steel. Product Mix Geographical and product mix possibilities. The combined entity will emerge as the second most geographically diversified steel company. It will have access to high valued- added product mix and strong market positions in automotive, construction and packaging. Reputation The Corus acquisition allowed Tata Steel to enhance its reputation and acquire a Global name. This has the potential to open up other markets for steel for Tata Steel, improve its bargaining power with respect to suppliers and customers. Sharing Complimentary Strengths Corus has a strong Research and Development (the number one position in the entire world) and product development for value added products in auto, construction and packaging which compliment what Tata Steel is doing in the fast growing Asian markets. A merger would complement their respective strengths. Low Cost Slabs Tata Steel has large supply of iron ore slabs from its green fields established in India in places like Orissa, Jharkhand, etc. Tata Steel can supply this slabs to Corus once these green fields in India are complete. In addition, there will be other ways to create value, linked to the projects of Tata Steel in India today. Patents and Technological know-how Corus has eighty-one patents that have been filed and assigned to the Corus by the United States Patent Trademark Office. Tatas completion of the acquisition meant it ended up becoming the owner of these patents. There would be technology transfer and cross-fertilization of RD capabilities between the two companies that specialized in different areas of the value chain. Distribution Network Tata has a strong retail and distribution network in India and SE Asia. This would give the European manufacturer a in-road into the emerging Asian markets. Tata was a major supplier to the Indian auto industry and the demand for value added steel products was growing in this market. Hence there would be a powerful combination of high quality developed and low cost high growth markets. With Tata Steel the cheapest manufacture of steel in the world the new company will become highly profitable. Strategic and Integration Committee A Strategic and Integration Committee was formulated to develop and execute the integration and further growth plans. Appropriate cross functional teams were formed under this committee to look into specific issues. There were some concerns over the lower return of capital employed and EBIDTA margins in 2007-08 which seemed to have declined. As debt would be repaid over the years, the EBIDTA margin as well as return of capital employed were likely to improve, but would need to be carefully watched. I/O Model of Above Average Returns Scanning At around eight per cent of GDP growth, India is seen well poised for a burst in development, a high increase in production output and a surge in demand for various goods from the common people of India. Industry experts are buoyant and bullish on the economic, demographic (in terms of young workforce, increase in incomes and hence an increase in consumption), and the helpful political environment (in terms of tax reliefs to industries, a commitment from the government to implement and introduce policies which further the interests of commerce). The Tatas were able to identify the early signals of potential changes in the environment and detect the changes that were underway. They were able to connect the dots and realize that as a result of the above changes in the environment the steel industry would look more and more attractive. There would be more need of steel due to the growth of car and aviation industries. Monitoring It was clear that in a fragmented steel industry to get the cost advantages and a competitive edge to exploit the emerging opportunities consolidation was needed in the steel segment. This logic was the basis for a spree of mergers and acquisitions pursued by Tata Steel. The rapid progress of the Indian automobile, engineering and construction industries means that the country will need more and more high-quality steel and it is seen that the global steel prices are on an incline. Access to Corus technology will, in course of time, allow Tata Steel to move up in the value chain. The acrimonious but successful Mittal-Arcelor deal also gave Tatas sufficient signal on consolidation being the emerging trend in the steel industry. Forecasting Although, Tata Steel was Indias largest integrated private sector steel company but globally ranked number 56 in terms of steel output. The Tatas realized that the Corus buy would instantly catapult Tata Steel to the position of 5th largest steel producer in the world, and provide access to the latest technology and strategic European markets as Corus had plants in Britain, Germany, France, the Netherlands and Belgium. It was also expected that Tata Steel would benefit from reduced production costs due to large volume, combined RD operations and broader product range. Corus acquisition would also dovetail with Tata Steels efforts to move up the value chain, as the former had built a reputation as an established supplier to the aviation and auto industries. Assessing Brazilà ¢Ã¢â€š ¬Ã… ¸s CSN and other players were also trying hard to acquire Corus which meant that a quick acquisition was the only alternative. Tatas had and assessed the situation realized the need to act quickly and swiftly. It was clear that a small window for a big opportunity had opened up for Tata steel. This was a risky consolidation, considering that the future of Tata Steel is dependent mostly on Corus performance but it is well known that entrepreneurial decisions involve risk. We can understand that it may be one of the entrepreneurial decisions that Tata Steel had to make for the future success of the company. Aftermath of the deal Post merger integration is the biggest challenge in any acquisition. But before we look at the challenges, let us first look at the immediate synergies that TATA Steel aimed at before going for the deal and how it obtained them after the deal. Synergies Advantages After the acquisition, TATA-Corus combine became the 5th largest steel producer in the world with an output around a quarter that of the largest, Arcelor Mittal. Before the deal, TATA Steel was not ranked among the top 50 global steel producers in 2005/06, producing just 5.3mn tonnes. Corus, by contrast was the 9th largest producer with an output of 18.2mn tonnes. Economies of scale have a very significant impact on any steel firm. This deal came at a time when consolidation in the steel industry was a necessity with increase in demand from China A growing presence in Asia and the developed European economies would surely leverage the economies of scale from Europe and harness growth from Asia The two corporations made a formidable presence a presence in 42 countries, a combined capacity of 25mn tonnes and a collective sales turnover of Rs 1 lac cr (March 2008 estimates at the time of the deal) The deal came at a perfect time for TATA Steel after its successful acquisitions of Singapores NatSteel in 2004 and Thailands Millennium Steel in 2005. Acquisition of Corus, a steel giant in the Western markets, gave TATA access to the vast distribution network as well as the opportunity to become a global player. TATA is a low cost producer of steel and Corus is famous for its value additions and technology especially in manufacturing of steel used in high rise buildings. The acquisition paved the way for TATA to access the RD facilities of Corus as well as to introduce its low cost production techniques in the Western markets. This can be considered as one of the most important synergies in the entire deal. The deal helped the TATAs in getting 20mn tonnes of steel capacity at virtually half the price as such a capacity would have required nothing less than $20bn $25bn as per 2006/07 estimates. The synergie

The concept of self

The concept of self 1. Self Concept. The concept of self is relatively hard to describe, as the individual person, began to consider himself as an individual person, without considering him as a part of group or a society. Sirgy (1982) described the self concept as the persons reflection of having an orientation or regard to himself as an object. The notion behind the self concept is the ideology that every human life is unique, he or she is individual object and need to be nurtured Solomon,Bamossy,Askergaard, Hogg (2006). Again this concept is very much depend upon the society, where self is living in. In western culture, where there is a individualistic mode of life and in eastern culture, the individual is strictly a part of society or a family, they live in collectivist society. According to Markin (1979) the self concept is a multi dimensional concept, which consists of five components like Ideal Self, The apparent self, the social self and the actual self while Solomon,Bamossy,Askergaard, Hogg (2006) identifies the component of Self concept as Self Esteem, Ideal and real selves, multiple selves, Symbolic interactionism, the looking glass self, and Self Consciousness. Schiff man and Kanuk(2004) identifies the components of Self as, One or Multiple selves, The Makeup of the self Image, the extended self, Altering the self, Virtual personality or Self. Self Esteem Self esteem refers to the positivity of a person; a person with High self esteem is likely to be confident and will be at the centre of attraction and a person with comparatively less self esteem, will consume the products that will make him/her more confident. Peoples with low self esteem tend to shrink their activities in order to avoid humiliation and embarrassment. (Solomon, Bamossy, Askergaard, Hogg, 2006) Real and Ideal selves According to Solomon, Bamossy, Askergaard, and Hogg, (2006) the real self is the current status of a person, with more realistic characters and attributes. While the Ideal self is our Dream to attain a certain position in life, this concept is greatly influenced by the advertisements or role models where people try to have an image of his/her role model. The ideal self of a person influence the level of self esteem in that particular person, by comparing the current status with the ideal status. Schiff man and Kanuk (2004) define ideal self as a state of condition, which consumers prefer to see themselves in Future, while the real self is the position where a consumer sees himself/herself in the current situation. Most people experience a large gap between their actual self and the ideal self, and it affects the self esteem of that peoples, so it is assumed that, this peoples consumer a variety of products which reflects their Ideal self in order to reduce the gap between their actual self and ideal self. In other words, consumption of symbols is a pathway to attain their ideal self image. Multiple selves According to Solomon, Bamossy, Askergaard, Hogg, (2006) Markus and Kunda (1986), Schiffman and Kanuk (2004) a person is having many selves according the situation and according to the peoples he or she interacts with. During these times any one of the multiple self will be active, while other selves remain temporarily dormant. The Looking glass self In this concept, the individual reads, his self image with the aid of the signal and vibration bounced by others in the society. The desire to view and describe ourselves operates like a psychological sonar, which reads and analysis the signals emitting by others. The result can be varied according to the person who judge the individual and how the individual interpreting the signals, Solomon, Bamossy, Askergaard, Hogg (2006) Self Conscious Solomon,Bamossy,Askergaard, Hogg (2006) analyse the self conscious as the assessment of the real self by an individual Altering self With the aid of accessories and makeovers, an individual is trying to alter the self, to become a different self or an improved self, the notion of altering self is the affinity of the individual to express their individuality by creating a new self, at the same time maintaining the real self (Schiffman and Kanuk, 2004). The Extended Self Extended self is defined as the usage of props and setting by an individual to define their social roles, they consider these props and setting as an integral part of their selves. Solomon, Bamossy,Askergaard, Hogg (2006) (Schiffman and Kanuk, 2004). The importance of self concept analysis in the field of business was described by Sirgy (1982). He analysed that consumers tend to buy products, which relates to the actual self of themselves. While Adam et al (1993) outlined that with the consumption people are projecting a picture of selves to themselves and to others. Consumers tend to buy products, in which they see their actual self. Graeff(1996) found that the consumers perception about a particular brand is entirely depend upon the perception closeness with the brand image and the self image. Solomon,Bamossy,Askergaard, Hogg (2006) analyse that consumption activities are a kind of self definition of an individual and by consumption the individual project the consistency between their values. Through this Essay, the researcher is interpreting own the perception about Self concept to consuming for self esteem for attaining Ideal self image and multiple self. So it is Important for a marketer to understand the Self concept of the consumer, in order to cater the needs and requirement of the consumer at its best. In the consumption diary, the researcher denotes the passion and dream to be a privileged personality, (p.9, 18 and 19) who enjoys the luxury of having a private jet like Mr.Mukesh Ambani or to flying in First and Business class cabins, to buy a car for himself and for the family with his fist salary the researcher is also keen to get a leather jacket like the participants of MTV roadies, all these facts implies the desire to attain an ideal self image, while the researcher also aware of the real self, the researcher comments about his current and jobless situation (p, 16, 9) The researcher is also afraid of his physical appearance while purchasing Jackets, can be interpreted as his immense self conscious while making a purchase or can be interpreted to the lack of self esteem, with these details, it is assumed that the researcher lacks consider amount of self esteem as the gap between his real self and ideal self is too big (Solomon,Bamossy,Askergaard, Hogg.2006) 1. Cultural Theory In the cultural theory, the researcher analysis the affect and influence of his religious ethical or rituals values in his consumption pattern. Different academics, described the concept of culture as; Solomon,Bamossy,Askergaard, Hogg (2006) commented that, Culture is a prism, through which an individual analyse products and try to make their sense out of their own and other peoples consumer behaviour. The culture of a particular individual determines the priority of the purchase and attitudes towards different situations, activities, and substances. Again the influence of the culture is varied according to the geographical locations. The western culture implies more on the individualistic method of consumption, while eastern culture emphasise the importance of collectivism. (Jamal, et al 2003) describes the components which makes the cultural decisions, he views that the values and the ethical believes are the two major components which determines the cultural decision of an individual. Hoffstede (1991) analysis that the culture is biased according to the culture and the condition in which an individual is raised and lived through and these conditions determine the consumer pattern of the individual. Sood and Nasu (1995) comments that the nationality of a person also can influence the formation of the culture and values. The moral conducts are described according to two methods, the deontological and the technological method According to the deontolical method, the moral conducts and the religious beliefs are inherited to a person from the ancestors or from the previous society. (Singhapakdi and Vittel, 1993 and Murphy and Laczniak, 1981). The religion is described as a bunch of moral codes, which governs the conduct of an individual or a group of individuals or a society (Wines and Napier, 1992). Religion is considered to a unified system of beliefs and practices relative to sacred things (Emily, cited in Nejdet Delener, the effects of religious factors on a perceived risk in durable goods purchase decisions, 1990). Religiosity can be stricter than religion as religiosity is the degree of belief that a person hold in his ideas and life (Delener, 1991). The diary (pp. 15) describes the affinity of the researcher to have a traditional food, on the day of religious festival, it says in the dairy that, other room mates were not bothered about the special lunch on that auspicious day of Bakrid, but the researchers mind constantly pushed him to make a move or initiative to make a special dish. This shows his loyalty to the tradition and routine he has been keeping since ages, even not at his home he still strive to make full out of that belief and the researcher go Lidl and prepares food for himself and to the room mates. From the diary abstract (pp. 11) tells that the researcher wanted to have a body massage as his back aches due to the lifestyle he maintains in UK, The researcher is exceptionally cautious about the morality and the cultural and ethical values he inherited from the ancestors, as he avoids doing a body massage, as the massage parlour was ran by women, and his culture doesnt allow him to be touched by other women. This shows the influence of ancestral and the societal situation where the researcher raised, when it comes to morality of the researcher. The religion is one of the main factor which influence the food consumption and the degree of affect is directly proportional to the extent of influence that religion made in that person and how far he follows the religion. Islam is a religion governed by a set of rules and customs which is evaluated and judged by five pillars, consuming halal food is a must for religious people in Islam. The consumption of Halal meat is not an automated process among Muslims. They consume halal food as a form of personal conviction and it is observed that (Bonne, et al 2007). Unlike in the past, the social and the political presence Muslims are increased and they began to ask for the halal labelled meat (Riaz and Chaudry, 2004) Throughout the Diary, the researcher described about the restriction of consuming certain food in his new surroundings. The researcher has demonstrated the precaution that he makes, while he makes a decision to dine outside his house. Another loyalty of the researcher, towards the religion can be seen when he visited a Super Market See Woo where he see the Pork and the halal chicken are served together, and he feels like two opposite poles are served together. From the exact diary words of the researcher it is understood that, it has generated a gross feeling in the mind of the researcher, (pp.11.) On the other occasion the researcher, was doubtful about a food (P), he bought from a shop, and his mind was constantly asking him that, is it allowed food? The researcher clarified his doubt to the vendor before he tasted it, that is that food halal one or not? The researcher felt constant insecurity while consume food outside his house, this kind of insecurity has been described by Nedjet Delener in 1990, Religious individual tends to perceive higher risks during the consumption or while making consumptio n decision, while less religious peoples feel less secure and tends to have comparatively low degree of risks during their consumption decision. From these facts mentioned above, it is assumed that the researcher is highly influenced by religious rituals and symbols while making a purchase decision. 2. Decision making theory In the decision making process the researcher is focusing on the problem solving perspective of Decision making. The consumer decision making process is not a single process, it is associated with many factors (Henry Assael, 1998) The Idea of developing the problem solving perspective of decision making theory is the assumption of dominant school that, the consumer as an Cognitive object while making consumption decision, (Schiff man and Kanuk, 2004). The decision-making perspective holds that buying behaviour results from consumers engaging in a problem-solving task in which they move through a series of stages (John.C.Mowen, 1988, .p15) According to this concept, the consumer moves through a series of Seven stages, before making a purchase decision.(Roger et al, 2001) need recognition. Need recognition occurs when there is a alarming difference between the actual self and the desired self (Solomon et at, 2006, and Roger et al, 2001, Henry Assael, 1998). Recognition of needs happens when a person brazen out with a problem or deficiency (Schiff man et al 2004). Henry (1998) comments that the need in a person can be aroused with variety of inputs such as the past experience of the customer. It is true that the needs are often spurred by the marketing efforts, butThe role of a marketer in creating a need, is not to manipulate the consumer, but to make understand the consumer what his need is, and to direct towards a specific brand, even a pre existing demand is there (Solomon et al, 2006) Pre purchase search From the diary extract (P..) the researcher is trying to obtain the prices of telephone, which the researcher wanted to buy, to call home country. During the pre purchase search, the researcher opts for checking the available information about the telephone through eBay. In order to get a vague idea about the price of telephone sets in United Kingdom, the researcher thought it is best way to search online, and particularly eBay, as a form of external information got from the room mates; it was easy for the researcher to choose eBay for best deals and for an outline about prices. Information search is the mode of survey, which a consumer employs to make an appropriate purchasing decision. ( Solomon etal, 2006) Pre purchase search begin with recognition of need that can be rectified with consumption. There are two kinds of search sources, the internal information source and the external information source. Internal source is the information in the memory from the previous experience of purchase. Past experience gives a huge amount of information about the current choice. If the consumer lacks the past experience, he or she will start searching actively for the information from the external sources like Advertisements and websites, whichever is possible (Schiffman etal 2004) Roger etal (2001) added one more source of information that is accidental or situational information, which the consumer gets by chance or by situation. Here comes the importance of Marketing communication. The correct market communication at the correct time and place, will let the consumer to understand the details about the product and which lead the consumer to get attracted towards the product. Evaluation of alternatives From the diary (p) the researcher demonstrated a perfect example for evaluating the alternatives by searching for best deal for Air tickets to India. After listening to the different fares, the researcher began to evaluate the alternatives, by comparing which one to go for and how it benefits him as a consumer. By comparing the possible alternatives, the researcher decided to nullify the bad deals and go for the best one. This stage is the most time consuming stage for a consumer that is to evaluate the options available from the information, before making a purchasing decision. The modern consumers are flooded with thousands of choices with thousands of brands waiting for the attention of the potential consumer. Solomon et al (2006). At this point of time, the consumers ask themselves a question that, what are my options? and Which is the best? consumers use either memory or the external source to sort the option (roger et al 1998). Decision making process. Throughout the diary, the researcher demonstrated the quest for best deals when purchasing the house holds. According to Schiffman et al (2004) there are three mode of purchase, they are Trial Purchase, repeated purchase and Long term commitment purchase. Where a trial purchase comprised of buying product for first time in little quantity to check the product directly, if the product appeared satisfactory, it is likely to buy that product again for consumption, which is termed as Repeated buying and this mode of repeated buying can lead the customer towards loyalty to that particular brand, which leads to the Long term commitment purchase. While Roger et al (2001) considers there are two phases of purchase behaviours among consumers. The first phase is switching retailer or rely on other mode of retailing such as television or internet or catalogs while the second phase consist of switching the models or the products within the same stores. This phase is aided with the capabilities of the sales person the arrangement pattern of the product to attract the attention of the consumer. The cons umer moves with an agenda during the first three stages of decision making, while Roger argues that, the stage four is not under the complete control of the consumer, as many other factors influence the purchase decision. At this phase, the role of a marketer is important; the consumer mind will be swinging in the confusion of which product to chose. By understanding the consumer behaviour a marketer can lead the consumer the product which they wanted. The way of arranging the product is also an important factor to induce an impulsive purchase at in store condition.( Roger et al, 2001) Consumption Consumption can occur either immediately or delayed, and through consumption the satisfaction of the consumer can be derived. Consumption of a product is depending up on the promotions and offers a consumer can get, if there is best deal offers, it is likely to stock the products, for future use. (Solomon, et al) Post consumption evaluation After the purchase, the consumer starts evaluating the product, if the performance of the product matches the consumer expectation it is likely for the consumer to get satisfied, and vice versa (Schiffman et al, 2004) Roger et al argues, it is important to understand how the consumer use the product, if the consumer abuses the product, it is less likely for the consumer to get satisfied with the product. For making the consumer understand about the usage of the product, to prevent dissatisfaction, the company introduced variety of Instructions and Warranties. With this facilities it is likely for a customer to opt for a re purchase.

Physics of Lightning Essay -- physics lightning thunder weather

In ancient times, lightning was seen as a tool of the gods. In Viking legend, it was Thor’s hammer striking an anvil in the sky that was responsible for lightning. For the Greeks, it was Zeus who threw lightning down to the earth. North American Indian tribes thought that lightning was produced by a mystical bird with flashing feathers whose flapping caused thunder. Even now, hundreds of years after the first scientific work with lightning, people remain in awe of its power. In the 18th century, the first systematic scientific study of lightning was carried out by Benjamin Franklin. Before Franklin’s experiments, electrical science had grown to the point of separating positive and negative charges, and had developed primitive capacitors. The sparks produced in laboratories were noted as similar to lightning, but it was Franklin who designed an experiment to prove that lightning was electrical. Benjamin Franklin believed that clouds must be electrically charged, which would mean that lightning must also be electrical. For his first experiment, he stood on an electrical stand with an iron rod in one hand to achieve an electrical discharge between the other hand and the ground. If Franklin’s belief that the clouds were electrically charged was correct, then sparks should leap between the iron rod and a grounded wire held by and insulating wax candle. This test method was published in London and performed in both England and France. Thomas Francois D’Alibard of France was the first to successfully perform this experiment in May of 1752, when sparks were seen jumping from the iron rod during a thunderstorm. Before Benjamin Franklin achieved results from his first experiment, he devised a better way of testing his hyp... ...wave). Lightning is often seen long before its thunder is heard. This is because sound travels at about 343 m/s though air, much more slowly than 3.00x108 m/s, the speed of light. While a lightning strike takes less than a second to complete, the sound of its thunder often lasts much longer. There are many reasons for this. The shape of the lightning bolt is a major factor, as all parts are not an equal distance from the listener. Sound produced by closer portions of the bolt will be the first of the thunder a listener hears, and sound produced by portions of the bolt that are farther away will be heard later. Another factor is that objects on the ground interfere with the sound, and echoes from hills and other objects can perpetuate thunder. Often lightning occurs in groups, so the sounds from multiple bolts sometimes overlap to cause longer lasting thunder.

The Lie of the Land :: Haydn Middleton Davids Story

The Lie of the Land The Lie of the Land, written by Haydn Middleton, is a novel about protagonist David Nennius and his past, present, and future. David tells readers about his past through sections entitled "David's Story," a narrative that he is writing in which he reveals secrets about his conception, birth, life, and impending death. Through this, we learn that David is the son of the sky and that there is a woman who has claimed him as her own. This woman haunts him with the statement "I know you, I have found you, and I will not let you go," and in the end, he will "dance in the brightest light the dance of death at the gateway to Albion" (p. 84-85). He constantly lives in this woman's shadow and cannot know happiness with another, so after his is married to Melissa and fathers a son, Art, David knew "that he would dance before his time" and "that there would be more than one end" (188). In this so-called "end before the end," David found his 13 year old son being forced to give a man oral sex in a bathroom in a park, and, outraged, David kills the man. Soon after, Melissa and Art leave, and after some time, David believes that he is given a new beginning when he finds a man named Quinn at his allotment on top of the mound under which he had buried the man he murdered. In time, David loses faith in this false hope and believes that he has to die to atone for what he has done. This he shares with a girl named Rachel whom he meets at the Good Samaritan center. When Quinn and Rachel find David's Story, they are convinced that it is "the beginning of a very long suicide note," and the two intervene to keep David from taking his own life (154). Middleton, Haydn. The Lie of the Land. New York: Ballantine Books, 1989. Ordinary People Ordinary People is a novel about an adolescent boy named Conrad Jarrett. The story begins after Conrad has returned home from spending eight months in a hospital for attempting to commit suicide after he was involved in a sailing accident in which his older brother Jordan was killed. In the accident, a storm arose while the boys were on the lake with their sailboat. The two worked to control the boat, but it tipped and they fell into the icy water.

Dust Bowl Essay -- American History

According to answers.com, a dust bowl is a region reduced to aridity by drought and dust storms. The best-known dust bowl is doubtless the one that hit the United States between 1933 and 1939. One major cause of that Dust Bowl was severe droughts during the 1930’s. The other cause was capitalism. Over-farming and grazing in order to achieve high profits killed of much of the plain’s grassland and when winds approached, nothing was there to hold the devastated soil on the ground. The Dust Bowl affected the Great Plains which consist of parts of the U.S. states of Colorado, Kansas, Montana, Nebraska, New Mexico, North Dakota, Oklahoma, South Dakota, Texas and Wyoming. Storms also reached the East Coast of the United States. The Dust Bowl especially affected Kansas and Oklahoma, where people died from dust pneumonia and starvation. Mrs. Flora Robertson, former resident of Oklahoma, describes a Dust Bowl as a â€Å"huge black cloud†. Bon Turner, another U.S. citizen whose life was affected by the dust storms, reports that one day he left a milk bottle on his back porch. When he came back after a while, it was two-thirds filled with dust. Bon Turner had to break dust on water like ice to water his horses. Lawrence Svobida, a Kansas wheat farmer, speaks about farmers who decided to leave their farms; they loaded their possessions on trucks or trailers. He also mentions â€Å"endless processions† of people heading out of the Dust Bowl. Asked about the beginning of the Dust Bowl, he tells: "With the gales came the dust. Sometimes it was so thick that it completely hid the sun. Visibility ranged from nothing to fifty feet, the former when the eyes were filled with dirt which could not be avoided, even with goggles." Svobida is one of many farme... ...at over planting can do to the land, the majority of the United States just moved on and continued to treat the land just as poorly as before. John Pursell views chemical fertilizer as a thing that turns soil into â€Å"chemical wasteland† and mentions that today’s soil is often not good enough to resist heavy rainfalls. If John Pursell is to be believed, it is to say that maintenance of methods that provoked the Dust Bowl is a crime. The Dust Bowl was a disaster and must never happen again. This lesson has to be learned. Sources http://www.englishdiscourse.org (John Pursell) http://www.altoona.k12.wi.us (Flora Robertson) http://www.fhlbanks.com/ http://eh.net (James Butkiewicz, University of Delaware) http://americanart.si.edu http://faculty.washington.edu (James Gregory) http://www.pbs.org http://www.tqnyc.org http://www.epodunk.com http://www.answers.com

Business Ethics: Managing Corporate Citizenship and Sustainability in the Age of Globalization Essay

Ethical Dilemma Introduction                   Decisions are bound to be made on a daily basis whether on an individual or corporate level. The actions taken after the decision may lead to positive or negative outcomes. Ethics, therefore, is an important aspect that guides decision making both at a personal level and as a company. Ethics is described as the accepted moral values within a society or a given organization(Hoffman, Frederick, & Shwartz, 2013). It gives organizations and individual the outline of accepted practices and guides the decision making process to yield the preferable results without causing harm to others. Decisions define the success of any given organization because they are made on daily a basis, ranging from the top level management decisions to the support staff routine decision making. Ethical standards are important as they ensure all the stakeholders act sensibly. It is because of this reason that ethical standards play a crucial role in the success of an organization.                   One of the common ethical issues at an organizational level are the issues concerning the management of human resources. I have witnessed a human resource practitioner faced with an ethical dilemma concerning matters of recruitment, selection, fair working conditions, and remuneration(Seglin, 2011). The manager in charge of hiring and managing the human resources of any given organization face tough decision while performing their duties. Under the situation, I experienced, thehuman resource manager was put under pressure by the finance department to reduce the cost of labor for the company to realize sustainable profits. To achieve the set profit target of the company, the human resource manager had the alternative of hiring individual with low qualifications, or fire some of the employees to reduce the wage bill, or significantly reduce the salaries and benefits the employees are getting from the firm.                   From the above situation, the personnel manager is under an ethical dilemma situation. This is because both decisions and actions that he would take will have both positive and negative outcomes. First of all, it is ethical for the human resource manager to respect the directives from the senior management and serve the interest of the company to increase profits(Crane & Matten, 2012). However, by complying with these instructions will cause some employees to lose their jobs without sufficient or convincing reasons. This infringes the rights of the employees by terminating them without good reasons. If he employees with fewer skilled workers, the company will have a low wage bill, but the quality of work will be compromised and hence put the company at stake. Secondly, it is ethical for the human resource manager to protect the employees from termination without valid explanations(Seglin, 2011). Therefore, the manager is faced with two choices that both seem morally correct, but the outcomes have ethical considerations too. However, the manager was left with no choice and decided to terminate some employees, reduce salaries and employee benefits for the remaining workers.                   The stakeholders affected by the decision of the human resource manager include the management, the employees, both the fired and those still working, and the clients of the organization. The management is affected because the company is understaffed and the available resources underutilized. This means most of the resources go to waste and hence increasing losses made by the firm in the long run. By hiring low skilled personnel translates to low wages as directed by the management(Hoffman, Frederick, & Shwartz, 2013). However, the employees will give poor work quality due to lack of required expertise and hence the management may lose business to their close market rivals.                   The employees who are fired are adversely affected due to the loss of their source of lively hood. It is also against their right, to terminate their employment with no valid reason. Such individuals’ lives are changed and it affects their families too, if they were the main providers(Crane & Matten, 2012). The workers who remain on the job are also affected adversely due to the reduction in their number. They have to perform extra work and take extra time to finish what the terminated personnel used to do. With time such employees lose job morale due to low pay and long hours of work.                   Clients of the firm will also be affected by this decision because of the poor quality of work. Termination of some employees will make the organization to be understaffed and hence unable to meet the growing demand for their products. This affects the final consumers due to the forces of demand and supply. Hiring low skilled employees has a direct impact on the quality of work output(Seglin, 2011). The consumers will, therefore, receive substandard products. This reduces the utility clients derive from consuming the services and products of the firm.                   What would be considered the right outcome of the human resource manager’s decision, is the reduction of labor cost. Some of the things that constitute to high labor cost are high cost of wages and salaries, high number of employees, good working conditions, and employee benefits. By terminating the employment of some employees, the wage bill of the company reduces(Hoffman, Frederick, & Shwartz, 2013). The management will also offer lower salaries to less skilled employs and the reduction in the remuneration of the existing employees also reduce the labor cost. Therefore, the management would consider this outcome to be ‘right’ according to their expectations.                   However, it would also be considered wrong for the human resource boss to terminate employment agreements, reduce salaries and benefits, and hire less skilled. It is unethical for any employer to terminate the employment agreements of his/her workers without valid reasons. The process of selecting who is to be fired is also faced with ethical considerations and bias may prevail the process(Hoffman, Frederick, & Shwartz, 2013). Employees are supposed to be remunerated in accordance with their contribution to the company. Underpaying the employee for the benefit of the company is considered unethical and wrong. By reducing the number of employees in an organization makes the remaining workers work overtime. This is unethical as it denies them the crucial time to balance work and family. It is going against the rights of the workers by adding them more tasks without changing their terms of payment.                   The human resource manager made his decision based on the ethical principles of the firm. His decision to implement the directive of the management concerning cutting on labor cost, was influenced by the ethical principal that requires all the employees to respect the management and serve the interest of the company and not their own interest(Crane & Matten, 2012). If he would not implement the plan, then the human resource manager will be considered to have behaved in contempt of his seniors.The management of the firm spearhead the interest of the company and communicate it down to the least of ranks among the employees. In this case the firm’s interest is to reduce the cost incurred on manpower and hence increase the profit margins. As much as this decision when put to action affects livelihood of employees and the success of the firm, the human resource manager has to follow the code of ethics that requires him to respect decisions from persons at a higher rank than him.                   Biases also played a major role in influencing the decision and action taken by the personnel manager. He took the decision in favor of the management since he has a lower rank to them. By favoring them, he reduces the risk of him being questioned or even fired. If he does not be biased in his decision then he would not have served any of the parties due to the natter at hand being an ethical dilemma(Hoffman, Frederick, & Shwartz, 2013). This means that both the alternatives he had seemed morally right. It is ethical for him to protect employees from termination and remuneration reduction, because the company may incur high losses in the long run if that action is taken. However, it is also his moral responsibility to execute the plans and instructions of his colleagues in senior positions than him. Therefore, his action is justifiable as ethical. It is because of this dilemma that the manager had to apply bias for him to find a way out. This bias is mai nly as a result of seniority of management over the personnel manager.                   To address the ethical dilemma at hand, it would be wise for the human resource manager and the management to discuss the issue at hand. Then they organize a forum with both the management and the employees over the cost of labor. During the talks, the personnel manager will have a chance to explain to the management why the human resources are the most important resources for the success of the firm(Seglin, 2011). He would advise the top managers on other methods of costs reduction other than termination and pay cut. Measures such as doing massive advertising and publicity would increase the sales margin of the company. This is directly proportional to profits and it can be adopted instead of firing employees. The company may also invest more in the employees to increase their efficiency and skills. By doing productivity will go high and they will produce quality products and services that would more potential customers and increase sales turnouts. Conclusion                   Human beings and organizations are faced with situations that require decision making on a daily basis. Ethics is those values that are used to distinguish between right and wrong in an organization or a society. The decision made always have consequences and the consequences are judged based on the set moral values. Human resource practitioners are faced with ethical dilemmas in their daily responsibilities, that is; recruitment, selection, training, and termination. During this decisions and actions several stakeholders are affected. The management, the employees, and the clients are all affected by the decisions of the human resource manager. At times it is difficult to consider what is right and what is wrong due to both outcomes seeming morally correct. This situation is called an ethical dilemma. To overcome such situations all stakeholders of a given organization should frequently have meetings and talks to update the code of ethics and discuss so lutions to difficult ethical situations. References Crane, A., & Matten, D. (2012). Business Ethics: Managing Corporate Citizenship and Sustainability in the Age of Globalization. New York C: Oxford University Press. Hoffman, M., Frederick, R., & Shwartz, M. (2013). Business Ethics: Readings and Cases in Corporate Morality. New York: Wiley-Blackwell. Seglin, J. (2011). The Good, the Bad, and Your Business: Choosing Right When Ethical Dilemmas Pull You Apart . Boston: Wiley Publishers. Source document